Nkx2-6^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nkx2-6^em2(IMPC)H
• Name: NK2 homeobox 6; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:7425867
• Gene: Nkx2-6 Location: Chr14:69409251-69412967 bp, + strand Genetic Position: Chr14, 36.01 cM
• Alliance: Nkx2-6^em2(IMPC)H page
• IMPC: Nkx2-6 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 3 guides with spacer sequences CTCGCATAGCTAGCGTCGTA and GCTCGCATAGCTAGCGTCGT that targeted exon(s) ENSMUSE00000614231.5 ENSMUSE00001729585.1. This resulted in deletion(s) of 5 bp (location: Chr14:69412138-69412142; GRCm39), 103 bp (location: Chr14:69412553-69412655; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nkx2-6 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)