Lime1em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lime1em1(IMPC)Hmgu |
| Name: |
Lck interacting transmembrane adaptor 1; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:7425797 |
| Gene: |
Lime1 Location: Chr2:181023028-181025421 bp, + strand Genetic Position: Chr2, 103.63 cM, cytoband H4
|
| Alliance: |
Lime1em1(IMPC)Hmgu page
|
| IMPC: |
Lime1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AGACTGCATGAGCTGCACCG and TGAGGCCACTTATTCCAATG that targeted exon(s) ENSMUSE00001213408.2 ENSMUSE00001243928.2 ENSMUSE00001788136.1 ENSMUSE00001788152.1 ENSMUSE00001788159.1 ENSMUSE00001788161.1 ENSMUSE00001788162.1 ENSMUSE00001788178.1. This resulted in deletion(s) of 289 bp (location: Chr2:181024472-181024760; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|