Rnf186^em1Cya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf186^em1Cya
• Name: ring finger protein 186; endonuclease-mediated mutation 1, Cyagen Biosciences
• MGI ID: MGI:7413186
• Gene: Rnf186 Location: Chr4:138694430-138695676 bp, + strand Genetic Position: Chr4, 70.57 cM, cytoband D3
• Alliance: Rnf186^em1Cya page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs (TCATTGCCTTGGGGCCCACCGGG and CCCCTGTCCGCTGTGCCGAAAGG) created a 188 bp deletion resulting in a frameshift mutation. (J:327548)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rnf186 Mutation: 11 strains or lines available

References

• Original: J:327548 Zhang H, et al., RNF186 regulates EFNB1 (ephrin B1)-EPHB2-induced autophagy in the colonic epithelial cells for the maintenance of intestinal homeostasis. Autophagy. 2021 Oct;17(10):3030-3047
• All: 3 reference(s)