About   Help   FAQ
Saysd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Saysd1em1(IMPC)J
Name: SAYSVFN motif domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7378848
Gene: Saysd1  Location: Chr14:20125704-20133240 bp, - strand  Genetic Position: Chr14, 11.4 cM, cytoband A3
Alliance: Saysd1em1(IMPC)J page
IMPC: Saysd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGATAGGAGGAACAGC and AGAGGGACTGCTGTGCTCTC, which resulted in a 317 bp deletion beginning at Chromosome 14 position 20,077,304 bp and ending after 20,077,620 bp (GRCm38/mm10). This mutation deletes 317 bp from ENSMUSE00000413605 (exon 2) and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 48 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Saysd1 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory