About   Help   FAQ
Zmynd12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmynd12em1(IMPC)J
Name: zinc finger, MYND domain containing 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7344362
Gene: Zmynd12  Location: Chr4:119279881-119311096 bp, + strand  Genetic Position: Chr4, 55.38 cM
Alliance: Zmynd12em1(IMPC)J page
IMPC: Zmynd12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGTGCATATGAGCTCCA and GCTGTATTGATCCTTGTCAG, which resulted in a 355 bp deletion beginning at Chromosome 4 position 119,436,957 bp and ending after 119,437,311 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000662211 (exon 3) and 183 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zmynd12 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory