About   Help   FAQ
Cops9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cops9em1(IMPC)J
Name: COP9 signalosome subunit 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7343892
Gene: Cops9  Location: Chr1:92564867-92569707 bp, - strand  Genetic Position: Chr1, 46.55 cM
Alliance: Cops9em1(IMPC)J page
IMPC: Cops9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTGATAAAGAGGCTAGG and CTAAACAGTAGCCATTCGGA, which resulted in a 5306 bp deletion beginning at Chromosome 1 position 92,636,893 bp and ending after 92,642,198 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311837, ENSMUSE00001274912, and ENSMUSE00001239788 (exons 1-3) and 4868 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 10 bp insertion (CATCCTAAAC) 7 bp before the deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cops9 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory