About   Help   FAQ
Cluem1(CLU*)Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Cluem1(CLU*)Aduci
Name: clusterin; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID: MGI:7327106
Synonyms: Clu-h2kbKI
Gene: Clu  Location: Chr14:66206093-66218992 bp, + strand  Genetic Position: Chr14, 34.36 cM
Alliance: Cluem1(CLU*)Aduci page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Inserted expressed sequence)
Mutation:    Insertion
 
Cluem1(CLU*)Aduci expresses 1 gene
 
Mutation detailsGuide RNAs (GCAGATCCATATCTGGCTGA, TTGCCCCCTTCAGCCAGATA, TGAACTGCCCTCGCTTGTAC and CTTGAGTGCCTGTACAAGCG) are designed to replace part of the gene with an approximately 2kb region of human DNA sequence, including a human SNP rs2279590. To humanize the 3' end of the locus, the human SNP rs2279590 was introduced; the SNP has been associated with increased risk of late-onset Alzheimer's disease (LOAD). Specifically, DNA sequence from nucleotide position 27,596,915 to 27,598,786 (inclusive) on human chromosome 8 (GRCh38) is inserted between nucleotide positions 66,218,203 and 66,220,390 on mouse chromosome 14 (GRCm39), replacing the intervening mouse genomic DNA sequence. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Clu Mutation:  34 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory