About   Help   FAQ
Lkaaear1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lkaaear1em1(IMPC)J
Name: LKAAEAR motif containing 1 (IKAAEAR murine motif); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7327094
Gene: Lkaaear1  Location: Chr2:181338586-181340235 bp, - strand  Genetic Position: Chr2, 103.73 cM
Alliance: Lkaaear1em1(IMPC)J page
IMPC: Lkaaear1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CCACATCTAATGGCACTGAA and AGGACTATAAAACCCGACGA, which resulted in a 1214 bp deletion beginning at Chromosome 2 position 181,696,645 bp and ending after 181,697,858 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399911, ENSMUSE00000359021 and ENSMUSE00000388487 (exons 2,3 and 4) and 532 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lkaaear1 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory