Pak1^em2Yuwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pak1^em2Yuwa
• Name: p21 (RAC1) activated kinase 1; endonuclease-mediated mutation 2, Yuichi Wakabayashi
• MGI ID: MGI:7284812
• Synonyms: Pak1-3''UTR-171^A
• Gene: Pak1 Location: Chr7:97437748-97561588 bp, + strand Genetic Position: Chr7, 53.57 cM
• Alliance: Pak1^em2Yuwa page

Mutation origin

• Strain of Origin: FVB/N

Mutation description

• Allele Type: Endonuclease-mediated (No functional change)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting GCACTGAAGAGAATTGCATCTGG) and an ssODN templates (CTGCTGGATTACTCGTCCAGATGCAATTCTCTTCAGTGCTAGACAGTTTC) with CRISPR technology, 3' UTR mutation c.*171T>A (minor allele of SNP rs3654376) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. (J:323200)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pak1 Mutation: 36 strains or lines available

References

• Original: J:323200 Okumura K, et al., Functional Polymorphism in Pak1-3' Untranslated Region Alters Skin Tumor Susceptibility by Alternative Polyadenylation. J Invest Dermatol. 2022 Mar 1
• All: 1 reference(s)