Pak1em1Yuwa
Endonuclease-mediated Allele Detail
|
Symbol: |
Pak1em1Yuwa |
Name: |
p21 (RAC1) activated kinase 1; endonuclease-mediated mutation 1, Yuichi Wakabayashi |
MGI ID: |
MGI:7284811 |
Synonyms: |
Pak1-3'UTR-6T |
Gene: |
Pak1 Location: Chr7:97437748-97561588 bp, + strand Genetic Position: Chr7, 53.57 cM
|
Alliance: |
Pak1em1Yuwa page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Using an sgRNA (targeting ACATGAGGCTGGGATGAGCGTGG) and an ssODN template (CTTGGCACATGAGGCTGGGATGAGCATGGTTTCAGTGATTGTTCTTGGTT) with CRISPR technology, 3' UTR mutation c.*6C>T (minor allele of SNP rs31627325) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. The mutation affects the use of the proximal polyadenylation signal and reduces susceptibility to developing skin papillomas.
(J:323200)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Pak1 Mutation: |
36 strains or lines available
|
|
Original: |
J:323200 Okumura K, et al., Functional Polymorphism in Pak1-3' Untranslated Region Alters Skin Tumor Susceptibility by Alternative Polyadenylation. J Invest Dermatol. 2022 Mar 1; |
All: |
1 reference(s) |
|