About   Help   FAQ
Pak1em1Yuwa
Endonuclease-mediated Allele Detail
Summary
Symbol: Pak1em1Yuwa
Name: p21 (RAC1) activated kinase 1; endonuclease-mediated mutation 1, Yuichi Wakabayashi
MGI ID: MGI:7284811
Synonyms: Pak1-3'UTR-6T
Gene: Pak1  Location: Chr7:97437748-97561588 bp, + strand  Genetic Position: Chr7, 53.57 cM
Alliance: Pak1em1Yuwa page
Mutation
origin
Strain of Origin:  FVB/N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsUsing an sgRNA (targeting ACATGAGGCTGGGATGAGCGTGG) and an ssODN template (CTTGGCACATGAGGCTGGGATGAGCATGGTTTCAGTGATTGTTCTTGGTT) with CRISPR technology, 3' UTR mutation c.*6C>T (minor allele of SNP rs31627325) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. The mutation affects the use of the proximal polyadenylation signal and reduces susceptibility to developing skin papillomas. (J:323200)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pak1 Mutation:  35 strains or lines available
References
Original:  J:323200 Okumura K, et al., Functional Polymorphism in Pak1-3' Untranslated Region Alters Skin Tumor Susceptibility by Alternative Polyadenylation. J Invest Dermatol. 2022 Mar 1;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory