About   Help   FAQ
Vcpem1Kene
Endonuclease-mediated Allele Detail
Summary
Symbol: Vcpem1Kene
Name: valosin containing protein; endonuclease-mediated mutation 1, Ken Ebihara
MGI ID: MGI:7284311
Synonyms: VcpA232E
Gene: Vcp  Location: Chr4:42979964-43000507 bp, - strand  Genetic Position: Chr4, 22.95 cM
Alliance: Vcpem1Kene page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsAlanine codon 232 (GCG) was changed to glutamic acid (GAG) (p.A232E) using an sgRNA (targeting CCTGCGCTGTTTAAGGCGATTGG) and an ssODN template (AGATAAAGGAGATGGTGGAGCTGCCACTGAGACATCCTGCACTGTTTAAAGAGATTGGTGTAAAGGTGAGTATCCTAAGGTCTGTGGGGAGTCT) with CRISPR/Cas9 technology. The gain-of-function mutation is located in the D1 ATPase domain of the encoded peptide and is associated with multisystem proteinopathy in humans. (J:325062)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vcp Mutation:  52 strains or lines available
References
Original:  J:325062 Shibuya K, et al., AAA-ATPase valosin-containing protein binds the transcription factor SREBP1 and promotes its proteolytic activation by rhomboid protease RHBDL4. J Biol Chem. 2022 Apr 14;298(6):101936
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory