Vcpem1Kene
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Vcpem1Kene |
| Name: |
valosin containing protein; endonuclease-mediated mutation 1, Ken Ebihara |
| MGI ID: |
MGI:7284311 |
| Synonyms: |
VcpA232E |
| Gene: |
Vcp Location: Chr4:42979964-43000507 bp, - strand Genetic Position: Chr4, 22.95 cM
|
| Alliance: |
Vcpem1Kene page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Alanine codon 232 (GCG) was changed to glutamic acid (GAG) (p.A232E) using an sgRNA (targeting CCTGCGCTGTTTAAGGCGATTGG) and an ssODN template (AGATAAAGGAGATGGTGGAGCTGCCACTGAGACATCCTGCACTGTTTAAAGAGATTGGTGTAAAGGTGAGTATCCTAAGGTCTGTGGGGAGTCT) with CRISPR/Cas9 technology. The gain-of-function mutation is located in the D1 ATPase domain of the encoded peptide and is associated with multisystem proteinopathy in humans.
(J:325062)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Vcp Mutation: |
52 strains or lines available
|
|
| Original: |
J:325062 Shibuya K, et al., AAA-ATPase valosin-containing protein binds the transcription factor SREBP1 and promotes its proteolytic activation by rhomboid protease RHBDL4. J Biol Chem. 2022 Apr 14;298(6):101936 |
| All: |
1 reference(s) |
|