About   Help   FAQ
Brme1em1Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: Brme1em1Amp
Name: break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Alberto M Pendas
MGI ID: MGI:7281853
Synonyms: Brme1-
Gene: Brme1  Location: Chr8:84874654-84899219 bp, + strand  Genetic Position: Chr8, 40.35 cM, cytoband C3
Alliance: Brme1em1Amp page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:303558
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology, using an sgRNA (targeting AACCTCAGGGACTCTCTCTG), generated a 40 bp deletion in exon 6 (GRCm39:chr8:84893258-84893298), leading to a frameshift and premature stop codon (p.Arg142Lysfs*18). (J:303558)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Brme1 Mutation:  25 strains or lines available
References
Original:  J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory