Otulinem1Gvl
Endonuclease-mediated Allele Detail
|
Symbol: |
Otulinem1Gvl |
Name: |
OTU deubiquitinase with linear linkage specificity; endonuclease-mediated mutation 1, Geert van Loo |
MGI ID: |
MGI:7256497 |
Synonyms: |
OTULINL272P |
Gene: |
Otulin Location: Chr15:27606005-27630793 bp, - strand Genetic Position: Chr15, 10.31 cM
|
Alliance: |
Otulinem1Gvl page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Using an sgRNA (targeting ATGACCCTGAACAGCTCCTG) and an ssODN template (AAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCCACTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTGAGTTGTGGC) with CRIRPR/Cas9 technology, leucine codon 272 (CTC) was changed to proline (CCA) (p.L272P). This mutation is associated with the OTULIN-related auto-inflammatory syndrome (ORAS or otulipenia) in humans.
(J:312394)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Otulin Mutation: |
22 strains or lines available
|
|
Original: |
J:312394 Hoste E, et al., OTULIN maintains skin homeostasis by controlling keratinocyte death and stem cell identity. Nat Commun. 2021 Oct 8;12(1):5913 |
All: |
1 reference(s) |
|