About   Help   FAQ
Otulinem1Gvl
Endonuclease-mediated Allele Detail
Summary
Symbol: Otulinem1Gvl
Name: OTU deubiquitinase with linear linkage specificity; endonuclease-mediated mutation 1, Geert van Loo
MGI ID: MGI:7256497
Synonyms: OTULINL272P
Gene: Otulin  Location: Chr15:27606005-27630793 bp, - strand  Genetic Position: Chr15, 10.31 cM
Alliance: Otulinem1Gvl page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting ATGACCCTGAACAGCTCCTG) and an ssODN template (AAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCCACTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTGAGTTGTGGC) with CRIRPR/Cas9 technology, leucine codon 272 (CTC) was changed to proline (CCA) (p.L272P). This mutation is associated with the OTULIN-related auto-inflammatory syndrome (ORAS or otulipenia) in humans. (J:312394)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Otulin Mutation:  22 strains or lines available
References
Original:  J:312394 Hoste E, et al., OTULIN maintains skin homeostasis by controlling keratinocyte death and stem cell identity. Nat Commun. 2021 Oct 8;12(1):5913
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory