About   Help   FAQ
Nek9em1Nmz
Endonuclease-mediated Allele Detail
Summary
Symbol: Nek9em1Nmz
Name: NIMA (never in mitosis gene a)-related expressed kinase 9; endonuclease-mediated mutation 1, Noboru Mizushima
MGI ID: MGI:6887930
Synonyms: LIR-mutant, Nek9W967A
Gene: Nek9  Location: Chr12:85346288-85386136 bp, - strand  Genetic Position: Chr12, 39.63 cM
Alliance: Nek9em1Nmz page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting TCGGAGTCCTGGTGCCTCCT) and an ssODN template (TCCTGAGGGCTATGTGGGCTCAGGAGACTAGAGGCTGGGTCGACAAGAGTCTGTTCCGAGGAGGCAGGCGGACTCCGAGTCTAAGTCAGGCTTTGGATCCATTTCCATTTCTTCCTTTGCTGTCTGGGT) with CRISPR/Cas9 technology, tryptophan codon 972 (TGG) in exon 22 was changed to alanine (GCC)(p.W972A). This mutation in the LC3-interacting region (LIR) of the encoded peptide prevents binding to this domain. (J:314513)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nek9 Mutation:  50 strains or lines available
References
Original:  J:314513 Yamamoto Y, et al., NEK9 regulates primary cilia formation by acting as a selective autophagy adaptor for MYH9/myosin IIA. Nat Commun. 2021 Jun 2;12(1):3292
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory