Nek9^em1Nmz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nek9^em1Nmz
• Name: NIMA (never in mitosis gene a)-related expressed kinase 9; endonuclease-mediated mutation 1, Noboru Mizushima
• MGI ID: MGI:6887930
• Synonyms: LIR-mutant, Nek9^W967A
• Gene: Nek9 Location: Chr12:85346288-85386136 bp, - strand Genetic Position: Chr12, 39.63 cM
• Alliance: Nek9^em1Nmz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting TCGGAGTCCTGGTGCCTCCT) and an ssODN template (TCCTGAGGGCTATGTGGGCTCAGGAGACTAGAGGCTGGGTCGACAAGAGTCTGTTCCGAGGAGGCAGGCGGACTCCGAGTCTAAGTCAGGCTTTGGATCCATTTCCATTTCTTCCTTTGCTGTCTGGGT) with CRISPR/Cas9 technology, tryptophan codon 972 (TGG) in exon 22 was changed to alanine (GCC)(p.W972A). This mutation in the LC3-interacting region (LIR) of the encoded peptide prevents binding to this domain. (J:314513)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nek9 Mutation: 50 strains or lines available

References

• Original: J:314513 Yamamoto Y, et al., NEK9 regulates primary cilia formation by acting as a selective autophagy adaptor for MYH9/myosin IIA. Nat Commun. 2021 Jun 2;12(1):3292
• All: 1 reference(s)