About   Help   FAQ
Tpm1em1Clo
Endonuclease-mediated Allele Detail
Summary
Symbol: Tpm1em1Clo
Name: tropomyosin 1, alpha; endonuclease-mediated mutation 1, Cecilia Lo
MGI ID: MGI:6879497
Synonyms: Tpm1K5del
Gene: Tpm1  Location: Chr9:66929872-66956688 bp, - strand  Genetic Position: Chr9, 36.27 cM
Alliance: Tpm1em1Clo page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Dominant negative, Humanized sequence, Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing an sgRNA (CTTCTTGATGGCGTCCATGG) and an ssODN template (TCCGCTGCCTAAGGGCCCCTCGCCACCGCCACCATGGACGCCATCAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC) with CRISPR/Cas9 technology, a mutation was engineered (deletion of one of lysine codons 5, 6 or 7 [p.K5del, p.K6del, p.K7del]) to mimic one linked to atrial septal defect (ASD) in human patients. (J:320916)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tpm1 Mutation:  31 strains or lines available
References
Original:  J:320916 Teekakirikul P, et al., Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability. Cell Rep Med. 2022;3
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory