About   Help   FAQ
Rab39bem6Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab39bem6Lutzy
Name: RAB39B, member RAS oncogene family; endonuclease-mediated mutation 6, Cathy Lutz
MGI ID: MGI:6879445
Synonyms: Rab39b cKO
Gene: Rab39b  Location: ChrX:74615652-74621837 bp, - strand  Genetic Position: ChrX, 38.26 cM
Alliance: Rab39bem6Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) to target exon 2. Donor DNAs were created to insert loxP sites flanking exon 2. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab39b Mutation:  9 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory