About   Help   FAQ
Prkdcem8Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Prkdcem8Lutzy
Name: protein kinase, DNA activated, catalytic polypeptide; endonuclease-mediated mutation 8, Cathy Lutz
MGI ID: MGI:6877123
Gene: Prkdc  Location: Chr16:15455730-15660099 bp, + strand  Genetic Position: Chr16, 10.09 cM, cytoband B1
Alliance: Prkdcem8Lutzy page
Mutation
origin
Strain of Origin:  BALB/cByJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

CRISPR/cas9 genome editing is used to generate a 390 nucleotide deletion that results in the complete loss of exon 5. Guide RNAs were selected to target upstream [ACTTTCCTATAACCCCAAGT ; CTTGGGAGTGACACCTACTT] and downstream [AAGTAGATTTAGATAAAACT ; AGTAGATTTAGATAAAACTT] of exon 5. (J:101977)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prkdc Mutation:  392 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory