Prkdc^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkdc^em8Lutzy
• Name: protein kinase, DNA activated, catalytic polypeptide; endonuclease-mediated mutation 8, Cathy Lutz
• MGI ID: MGI:6877123
• Gene: Prkdc Location: Chr16:15455730-15660099 bp, + strand Genetic Position: Chr16, 10.09 cM, cytoband B1
• Alliance: Prkdc^em8Lutzy page

Mutation origin

• Strain of Origin: BALB/cByJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to generate a 390 nucleotide deletion that results in the complete loss of exon 5. Guide RNAs were selected to target upstream [ACTTTCCTATAACCCCAAGT ; CTTGGGAGTGACACCTACTT] and downstream [AAGTAGATTTAGATAAAACT ; AGTAGATTTAGATAAAACTT] of exon 5. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prkdc Mutation: 400 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)