About   Help   FAQ
Il2rgem5Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Il2rgem5Lutzy
Name: interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 5, Cathy Lutz
MGI ID: MGI:6877078
Gene: Il2rg  Location: ChrX:100307991-100311861 bp, - strand  Genetic Position: ChrX, 43.9 cM
Alliance: Il2rgem5Lutzy page
Mutation
origin
Strain of Origin:  BALB/cByJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing is used to delete exon 3. Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified a founder harboring a complete loss of exon3. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Il2rg Mutation:  132 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory