Il2rg^em5Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il2rg^em5Lutzy
• Name: interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 5, Cathy Lutz
• MGI ID: MGI:6877078
• Gene: Il2rg Location: ChrX:100307991-100311861 bp, - strand Genetic Position: ChrX, 43.9 cM
• Alliance: Il2rg^em5Lutzy page

Mutation origin

• Strain of Origin: BALB/cByJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to delete exon 3. Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified a founder harboring a complete loss of exon3. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Il2rg Mutation: 132 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)