About   Help   FAQ
Rag2em8Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rag2em8Lutzy
Name: recombination activating gene 2; endonuclease-mediated mutation 8, Cathy Lutz
MGI ID: MGI:6877076
Gene: Rag2  Location: Chr2:101455063-101462874 bp, + strand  Genetic Position: Chr2, 53.87 cM
Alliance: Rag2em8Lutzy page
Mutation
origin
Strain of Origin:  NOD/ShiLtJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing is used to delete exon 3, Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 3 strains available      Cell Lines: 0 lines available
Carrying any Rag2 Mutation:  115 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory