Rag1^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rag1^em8Lutzy
• Name: recombination activating 1; endonuclease-mediated mutation 8, Cathy Lutz
• MGI ID: MGI:6877072
• Gene: Rag1 Location: Chr2:101468627-101479846 bp, - strand Genetic Position: Chr2, 53.88 cM
• Alliance: Rag1^em8Lutzy page

Mutation origin

• Strain of Origin: BALB/cByJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing is used to delete exon 2. Guide RNAs were selected to target upstream [AAGTGTCCCCAAATATTGTC ; ATCCTTTCCTGACAATATTT] and downstream [GCACCTAGCACATTGCCATG ; CACCTAGCACATTGCCATGT] of exon2. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rag1 Mutation: 133 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)