Rbpj^em4Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbpj^em4Lutzy
• Name: recombination signal binding protein for immunoglobulin kappa J region; endonuclease-mediated mutation 4, Cathy Lutz
• MGI ID: MGI:6870526
• Synonyms: Rbpj^indel
• Gene: Rbpj Location: Chr5:53713121-53814787 bp, + strand Genetic Position: Chr5, 29.37 cM, cytoband C1-C3
• Alliance: Rbpj^em4Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing using guide RNAs in the upstream (ACTTATACCATCAGTTAGAT; AGCAGGACCAATCTAACTGA) and downstream (CTGCTGGCTCATAGTGTGCG; CCCGCACACTATGAGCCAGC) regions of exon 4 originally designed to create a floxed conditional line instead created a 553 bp deletion incorporating exon 4 (TCTGCTTAAAGCAGGACCAATCT/del553/GCGGGGTAGCATTTAAAGGCAGCAC). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbpj Mutation: 191 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)