Cyp2c38^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cyp2c38^em1(IMPC)Bay
• Name: cytochrome P450, family 2, subfamily c, polypeptide 38; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6856676
• Gene: Cyp2c38 Location: Chr19:39379109-39451519 bp, - strand Genetic Position: Chr19, 34.03 cM, cytoband C3
• Alliance: Cyp2c38^em1(IMPC)Bay page
• IMPC: Cyp2c38 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cpf1 and guides with spacer sequences CACTATGTAGATTAAGGTACATG and GGTATGTGTGCTTAAGTCATATT that targeted exon(s) ENSMUSE00000997486.2 ENSMUSE00001091681.2. This resulted in deletion(s) of 600 bp (location: Chr19:39448636-39449235; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cyp2c38 Mutation: 30 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 4 reference(s)