About   Help   FAQ
Ercc6l2em2Mengf
Endonuclease-mediated Allele Detail
Summary
Symbol: Ercc6l2em2Mengf
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2; endonuclease-mediated mutation 2, Feilong Meng
MGI ID: MGI:6792078
Synonyms: Ercc6l2D270N
Gene: Ercc6l2  Location: Chr13:63963054-64048116 bp, + strand  Genetic Position: Chr13, 33.1 cM, cytoband B3
Alliance: Ercc6l2em2Mengf page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsAspartic acid codon 270 (GAT) in exon 5 was targeted for change to asparagine (AAT)(p.D270N) with an sgRNA (targeting CTTCATAACTTCTGTAACTC) and an ssODN template using CRISPR/Cas9 technology. This mutation in the DEAH-box helicase catalytic site of the encoded peptide mimics one that is found in some inherited bone marrow failure (BMF) patients and renders the enzyme catalytic-dead. (J:311900)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ercc6l2 Mutation:  38 strains or lines available
References
Original:  J:311900 Liu X, et al., ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res. 2020 Sep;30(9):732-744
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory