About   Help   FAQ
Rag2em3Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rag2em3Lutzy
Name: recombination activating gene 2; endonuclease-mediated mutation 3, Cathy Lutz
MGI ID: MGI:6753157
Synonyms: Rag2 del2,465
Gene: Rag2  Location: Chr2:101455063-101462874 bp, + strand  Genetic Position: Chr2, 53.87 cM
Alliance: Rag2em3Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsGuide RNAs [TGTCTGTGATTTCCTAACGG ; TTCACCTAATCACAAGTAAC] were selected to target intronic DNA flanking exon 3. The allele is a 2,465-nt deletion (GTAGTGTCTGTGATT//del 2,465//AGGTGAATAAAGATGTCAA) that results in the complete loss of exon 3 from the genome. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rag2 Mutation:  115 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  11 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory