Mip^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mip^em1(IMPC)H
• Name: major intrinsic protein of lens fiber; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6740470
• Gene: Mip Location: Chr10:128061707-128067681 bp, + strand Genetic Position: Chr10, 76.49 cM, cytoband D1
• Alliance: Mip^em1(IMPC)H page
• IMPC: Mip gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGTGACCGCAGGGTTGACAT, TCTTTGCTACATACGACGAG, TGGAGCCCATGTCAACCCTG, and TTGCTACATACGACGAGAGG that targeted exon(s) ENSMUSE00000379073.5 ENSMUSE00000150409.4. This resulted in deletion(s) of 10 bp (location: Chr10:128061945-128061954; GRCm39), 13 bp (location: Chr10:128062996-128063008; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Mip Mutation: 31 strains or lines available

References

• Original: J:169366 MouseBook^TM, Information obtained from MouseBook^TM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013
• All: 2 reference(s)