Zcchc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zcchc3^em1(IMPC)J
• Name: zinc finger, CCHC domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6731053
• Gene: Zcchc3 Location: Chr2:152253875-152256711 bp, - strand Genetic Position: Chr2, 74.98 cM
• Alliance: Zcchc3^em1(IMPC)J page
• IMPC: Zcchc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGCGTGGCGGGGCACTGA and CATGGCCACCGGCGGCGGAG, which resulted in a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39). This mutation deletes 1232 bp from ENSMUSE00000640007 (exon 1) from 2 nucleotides before the ATG start and 26 nucleotides after the TGA stop and should result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zcchc3 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)