About   Help   FAQ
Zcchc3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zcchc3em1(IMPC)J
Name: zinc finger, CCHC domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6731053
Gene: Zcchc3  Location: Chr2:152253875-152256711 bp, - strand  Genetic Position: Chr2, 74.98 cM
Alliance: Zcchc3em1(IMPC)J page
IMPC: Zcchc3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGCGTGGCGGGGCACTGA and CATGGCCACCGGCGGCGGAG, which resulted in a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39). This mutation deletes 1232 bp from ENSMUSE00000640007 (exon 1) from 2 nucleotides before the ATG start and 26 nucleotides after the TGA stop and should result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zcchc3 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory