Pnldc1^em1Jsha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pnldc1^em1Jsha
• Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1; endonuclease-mediated mutation 1, Jiahao Sha
• MGI ID: MGI:6725136
• Synonyms: Pnldc1^-, Pnldc1^delta7
• Gene: Pnldc1 Location: Chr17:13107616-13129117 bp, - strand Genetic Position: Chr17, 8.71 cM
• Alliance: Pnldc1^em1Jsha page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 5 was targeted with an sgRNA (targeting CCTGGACTCAGAGTTCTCTTTCC) using CRISPR/Cas9 technology, resulting in a 7 bp deletion. (J:307453)

Expression

In Mice Carrying this Mutation:

2 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pnldc1 Mutation: 30 strains or lines available

References

• Original: J:307453 Zhang Y, et al., An essential role for PNLDC1 in piRNA 3' end trimming and male fertility in mice. Cell Res. 2017 Nov;27(11):1392-1396
• All: 1 reference(s)