About   Help   FAQ
Panx1em2Icg
Endonuclease-mediated Allele Detail
Summary
Symbol: Panx1em2Icg
Name: pannexin 1; endonuclease-mediated mutation 2, Institute of Cytology and Genetics
MGI ID: MGI:6724374
Synonyms: Panx1em2Koral/Icg
Gene: Panx1  Location: Chr9:14917081-14956774 bp, - strand  Genetic Position: Chr9, 4.52 cM
Alliance: Panx1em2Icg page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 216 (CGG) in exon 4 was targeted for a change to histidine (CAC) (p.R216H) using an sgRNA (targeting GAAATACATTAGCTGCCGGCTGG) and an ssODN (GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC). The mutated amino-acid is conserved between human and mice and the mutation is found in a patient with symptoms of primary ovarian failure, severe intellectual disability, sensorineural hearing loss, and kyphosis. (J:307589)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Panx1 Mutation:  41 strains or lines available
References
Original:  J:307589 Battulin N, et al., Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision. Int J Mol Sci. 2021 May 17;22(10)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory