About   Help   FAQ
Fsip2em1Nali
Endonuclease-mediated Allele Detail
Summary
Symbol: Fsip2em1Nali
Name: fibrous sheath-interacting protein 2; endonuclease-mediated mutation 1, Na Li
MGI ID: MGI:6724283
Synonyms: Fsip2-KI
Gene: Fsip2  Location: Chr2:82773978-82839281 bp, + strand  Genetic Position: Chr2, 49.08 cM
Alliance: Fsip2em1Nali page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Insertion
 
Mutation detailsA C was inserted into exon 16 (c.8137insC) using an sgRNA (targeting ATCAAGAACAAGTTATCTGCTGG) and an ssODN (AGCAGTACTAAGACCAAAATCAAGAACAAGTTAagcGCTGGAGAGAAAAcCTCCAAGAGAGAGCAGACCAAAACCGCCCTTGGGCTGCCACAAACTCCAC) with CRISPR/Cas9 technology. This mutation mimics a mutation found in multiple morphological abnormalities of the sperm flagella (MMAF) patients. Reduced transcript expression was confirmed by RT-qPCR and absence of peptide expression by immunostaining. (J:307606)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fsip2 Mutation:  333 strains or lines available
References
Original:  J:307606 Fang X, et al., Hypomorphic and hypermorphic mouse models of Fsip2 indicate its dosage-dependent roles in sperm tail and acrosome formation. Development. 2021 Jun 1;148(11):dev199216
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory