About   Help   FAQ
Cr2em1(CR2,CR1*)Adiuj)
Endonuclease-mediated Allele Detail
Summary
Symbol: Cr2em1(CR2,CR1*)Adiuj)
Name: complement receptor 2; endonuclease-mediated mutation 1, MODEL-AD Center
MGI ID: MGI:6717167
Synonyms: hCR1*T1610S
Gene: Cr2  Location: Chr1:194819119-194859024 bp, - strand  Genetic Position: Chr1, 98.44 cM
Alliance: Cr2em1(CR2,CR1*)Adiuj) page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Cr2em1(CR2,CR1*)Adiuj) expresses 2 genes
 
Mutation detailsPlasmids encoding guide RNAs (AAATCTGATGATCTCAGTGA and TAAATCTGATGATCTCAGTG) are designed to change ACC to TCA resulting in an threonine to serine mutation at amino acid 1610 (T1610S) in exon 29 of the human CR1 gene, which was previously inserted into the mouse Cr2 locus. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cr2 Mutation:  84 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory