About   Help   FAQ
Zfp750em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp750em1(IMPC)J
Name: zinc finger protein 750; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6712815
Gene: Zfp750  Location: Chr11:121401804-121410159 bp, - strand  Genetic Position: Chr11, 85.49 cM
Alliance: Zfp750em1(IMPC)J page
IMPC: Zfp750 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCAGTGCTATGGCTAGAGAG and GACTCATTATCCTTTGTGTT, which resulted in a 2279 bp deletion beginning at Chromosome 11 position 121,402,605 bp and ending after 121,404,883 bp (GRCm39). This mutation deletes 1431 bp of ENSMUSE00000307208 exon 2, 127 bp of intron 2-3 and 721 bp of ENSMUSE00000367226 exon 3 including the splice acceptor, start site splice donor and termination codon. This allele is predicted to be a null. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp750 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory