Del(8Ddx19a-Ddx19b)1Chaw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(8Ddx19a-Ddx19b)1Chaw
• Name: deletion, Chr 8, Changjiang Weng 1
• MGI ID: MGI:6693696
• Synonyms: Ddx19-Delta30919
• Gene: Del(8Ddx19a-Ddx19b)1Chaw Location: unknown Genetic Position: Chr8, Syntenic

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The 3' UTR (in exon 12) of Ddx19a and exon 6 of Ddx19b were targeted using two pairs of TALENs (targeting TGGTACGGGTAAAACAGCTG, TGCAGGCTCTACTTGGCTGA, TAGCCCTGGCTTGGTGTGGT, TCTACCCTCCAAGTGCTG), resulting in the deletion of 30,919 bp of sequence including the 5' end of Ddx19a and 3' end of Ddx19b. (J:289833)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(8Ddx19a-Ddx19b)1Chaw Mutation: 0 strains or lines available

References

• Original: J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4
• All: 1 reference(s)