Gm16685^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm16685^em1Osb
• Name: predicted gene, 16685; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:6690649
• Synonyms: Gm16685^em1Vter, mNAIL^{deltaNFkappaB}
• Gene: Gm16685 Location: Chr3:7677765-7755061 bp, + strand Genetic Position: Chr3, 2.02 cM
• Alliance: Gm16685^em1Osb page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The genomic sequence containing two conserved NFKB-binding motifs, in the promoter upstream of the locus, was targeted with crRNAs (targeting AGGGTTTAAAAGCGCATCC and AGTCTGGGAGTTTCCGATCC) and tracrRNAs using CRISPR/Cas9 technology, resulting in an 79 bp deletion. RT-qPCR experiments confirmed the lack of transcript expression from this allele and hat there was no effect on the expression of the overlapping Il7 gene on the opposite strand. (J:303079)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gm16685 Mutation: 2 strains or lines available

References

• Original: J:303079 Akincilar SC, et al., NAIL: an evolutionarily conserved lncRNA essential for licensing coordinated activation of p38 and NFkappaB in colitis. Gut. 2020 Nov 25
• All: 1 reference(s)