About   Help   FAQ
Syngr3em1Pave
Endonuclease-mediated Allele Detail
Summary
Symbol: Syngr3em1Pave
Name: synaptogyrin 3; endonuclease-mediated mutation 1, Patrik Verstreken
MGI ID: MGI:6690242
Synonyms: synaptogyrin-3-
Gene: Syngr3  Location: Chr17:24904066-24908923 bp, - strand  Genetic Position: Chr17, 12.47 cM, cytoband A3.3
Alliance: Syngr3em1Pave page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Nucleotide substitutions
 
Mutation detailsExon 2 was targeted with a gRNA (targeting TTCGGACCGATTGTCAACGA) and an ssODN that introduces stop codons in all three reading frames (TAACTAGATGA), using CRISPR/Cas9 technology. Immunochemistry experiments confirmed the lack of peptide expression from this allele in the brain. (J:303506)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Syngr3 Mutation:  17 strains or lines available
References
Original:  J:303506 Largo-Barrientos P, et al., Lowering Synaptogyrin-3 expression rescues Tau-induced memory defects and synaptic loss in the presence of microglial activation. Neuron. 2021 Mar 3;109(5):767-777.e5
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory