About   Help   FAQ
Borcs5em1Jusb
Endonuclease-mediated Allele Detail
Summary
Symbol: Borcs5em1Jusb
Name: BLOC-1 related complex subunit 5; endonuclease-mediated mutation 1, Juan S Bonifacino
MGI ID: MGI:6510587
Synonyms: myrlysin-KO
Gene: Borcs5  Location: Chr6:134616475-134688147 bp, + strand  Genetic Position: Chr6, 65.77 cM
Alliance: Borcs5em1Jusb page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with two sgRNAs (targeting ATCTTGGCCCGATGTTTAGC and GGCTAAACATCGGGCCAAGA) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GATGGACGAT) that leads to a frameshift and premature stop codon. (J:299228)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 27 assay results
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Borcs5 Mutation:  22 strains or lines available
References
Original:  J:299228 De Pace R, et al., Synaptic Vesicle Precursors and Lysosomes Are Transported by Different Mechanisms in the Axon of Mammalian Neurons. Cell Rep. 2020 Jun 16;31(11):107775
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory