About   Help   FAQ
Mpzl1em1Ambt
Endonuclease-mediated Allele Detail
Summary
Symbol: Mpzl1em1Ambt
Name: myelin protein zero-like 1; endonuclease-mediated mutation 1, Anton M Bennett
MGI ID: MGI:6507873
Synonyms: Mpzl1Y242F, PZRY242F
Gene: Mpzl1  Location: Chr1:165419809-165462107 bp, - strand  Genetic Position: Chr1, 72.94 cM
Alliance: Mpzl1em1Ambt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 242 (TAC) was changed to a phenylalanine codon (TTC) (p.Y242F) through an A-to-T mutation (T-to-A on forward strand) using an sgRNA (targeting TCTAACTGTGCGTAAATGACTGG) and ssODN template with CRISPR/Cas9 technology. Also, two silent mutations were engineered upstream to create an AgeI diagnostic restriction site. The mutation renders the encoded peptide tyrosyl phosphorylation-defective, not only at the targeted Tyr242 but also at Tyr264. (J:301775)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mpzl1 Mutation:  19 strains or lines available
References
Original:  J:301775 Yi JS, et al., Tyrosyl phosphorylation of PZR promotes hypertrophic cardiomyopathy in PTPN11-associated Noonan syndrome with multiple lentigines. JCI Insight. 2020 Aug 6;5(15)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory