Mpzl1em1Ambt
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mpzl1em1Ambt |
| Name: |
myelin protein zero-like 1; endonuclease-mediated mutation 1, Anton M Bennett |
| MGI ID: |
MGI:6507873 |
| Synonyms: |
Mpzl1Y242F, PZRY242F |
| Gene: |
Mpzl1 Location: Chr1:165419809-165462107 bp, - strand Genetic Position: Chr1, 72.94 cM
|
| Alliance: |
Mpzl1em1Ambt page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Tyrosine codon 242 (TAC) was changed to a phenylalanine codon (TTC) (p.Y242F) through an A-to-T mutation (T-to-A on forward strand) using an sgRNA (targeting TCTAACTGTGCGTAAATGACTGG) and ssODN template with CRISPR/Cas9 technology. Also, two silent mutations were engineered upstream to create an AgeI diagnostic restriction site. The mutation renders the encoded peptide tyrosyl phosphorylation-defective, not only at the targeted Tyr242 but also at Tyr264.
(J:301775)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mpzl1 Mutation: |
19 strains or lines available
|
|
| Original: |
J:301775 Yi JS, et al., Tyrosyl phosphorylation of PZR promotes hypertrophic cardiomyopathy in PTPN11-associated Noonan syndrome with multiple lentigines. JCI Insight. 2020 Aug 6;5(15) |
| All: |
1 reference(s) |
|