About   Help   FAQ
Plpp7em1Eno
Endonuclease-mediated Allele Detail
Summary
Symbol: Plpp7em1Eno
Name: phospholipid phosphatase 7 (inactive); endonuclease-mediated mutation 1, Eric N Olson
MGI ID: MGI:6507762
Synonyms: Net39 KO
Gene: Plpp7  Location: Chr2:31985540-32000827 bp, + strand  Genetic Position: Chr2, 22.02 cM
Alliance: Plpp7em1Eno page
Mutation
origin
Strain of Origin:  (C57BL/6 x C3H)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA 559 bp deletion including exon 1 was engineered using sgRNAs (targeting TCCCTGAACCAGCCCCCCAA and GGGTTGGGCCGGCTCCCAGA) with CRISPR/Cas9 technology. RNA sequencing and Western blot analysis confirmed lack of expression from this allele. (J:302139)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 27 assay results
1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Plpp7 Mutation:  9 strains or lines available
References
Original:  J:302139 Ramirez-Martinez A, et al., The nuclear envelope protein Net39 is essential for muscle nuclear integrity and chromatin organization. Nat Commun. 2021 Jan 29;12(1):690
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory