About   Help   FAQ
Cacng2em1Tern
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacng2em1Tern
Name: calcium channel, voltage-dependent, gamma subunit 2; endonuclease-mediated mutation 1, Terunaga Nakagawa
MGI ID: MGI:6505622
Synonyms: CACNG2-
Gene: Cacng2  Location: Chr15:77875948-78004228 bp, - strand  Genetic Position: Chr15, 36.92 cM
Alliance: Cacng2em1Tern page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsExon 1 was targeted with an sgRNA (targeting TGAAACCAGCAAGAAGAACG) and an ssODN template, containing a A-to-T mutation (T-to-A on forward strand) in lysine codon 53, using CRISPR/Cas9 technology. The resulting mutation causes premature translation termination (p.K53*). (J:301313)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cacng2 Mutation:  26 strains or lines available
References
Original:  J:301313 Kamalova A, et al., AMPA Receptor Auxiliary Subunit GSG1L Suppresses Short-Term Facilitation in Corticothalamic Synapses and Determines Seizure Susceptibility. Cell Rep. 2020 Jul 21;32(3):107921
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory