About   Help   FAQ
Rbpjem2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbpjem2Lutzy
Name: recombination signal binding protein for immunoglobulin kappa J region; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6503833
Synonyms: Rbpjflox
Gene: Rbpj  Location: Chr5:53713121-53814787 bp, + strand  Genetic Position: Chr5, 29.37 cM, cytoband C1-C3
Alliance: Rbpjem2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing is used to insert loxP sites on either side of exon 4. A double stranded oligonucleotide donor DNA with a 1.6-kb left arm, a 1.1-kb right arm, two loxP sequence elements [with the sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT] and all of exon 4 is used to generate the floxed allele. The 5' loxP sequence is positioned 211nt 5' of exon 4 and the 3' loxP sequence is positioned 170nt 3' of exon 4. Progeny were screened by DNA sequencing to identify correctly targeted pups. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rbpj Mutation:  191 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  8 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory