Rbpj^em2Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbpj^em2Lutzy
• Name: recombination signal binding protein for immunoglobulin kappa J region; endonuclease-mediated mutation 2, Cathy Lutz
• MGI ID: MGI:6503833
• Synonyms: Rbpj^flox
• Gene: Rbpj Location: Chr5:53713121-53814787 bp, + strand Genetic Position: Chr5, 29.37 cM, cytoband C1-C3
• Alliance: Rbpj^em2Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing is used to insert loxP sites on either side of exon 4. A double stranded oligonucleotide donor DNA with a 1.6-kb left arm, a 1.1-kb right arm, two loxP sequence elements [with the sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT] and all of exon 4 is used to generate the floxed allele. The 5' loxP sequence is positioned 211nt 5' of exon 4 and the 3' loxP sequence is positioned 170nt 3' of exon 4. Progeny were screened by DNA sequencing to identify correctly targeted pups. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbpj Mutation: 191 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 8 reference(s)