Ythdf1^em2Jhha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ythdf1^em2Jhha
• Name: YTH N6-methyladenosine RNA binding protein 1; endonuclease-mediated mutation 2, Jacob Hanna
• MGI ID: MGI:6491616
• Synonyms: Ythdf1^-
• Gene: Ythdf1 Location: Chr2:180546170-180562729 bp, - strand Genetic Position: Chr2, 103.5 cM
• Alliance: Ythdf1^em2Jhha page

Mutation origin

• Strain of Origin: (C57BL/6 x BALB/c)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 3 was targeted with sgRNAs (targeting ATTGGACTGTCCAGAAAGGT) using CRISPR/Cas9 technology, resulting in a 10 bp deletion. (J:299108)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ythdf1 Mutation: 36 strains or lines available

References

• Original: J:299108 Lasman L, et al., Context-dependent functional compensation between Ythdf m(6)A reader proteins. Genes Dev. 2020 Oct 1;34(19-20):1373-1391
• All: 1 reference(s)