About   Help   FAQ
Pole3em4Tbo
Endonuclease-mediated Allele Detail
Summary
Symbol: Pole3em4Tbo
Name: polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 4, Thomas Boehm
MGI ID: MGI:6490636
Synonyms: Pole3m4
Gene: Pole3  Location: Chr4:62440889-62443305 bp, - strand  Genetic Position: Chr4, 33.17 cM, cytoband C1
Alliance: Pole3em4Tbo page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsA 2 bp insertion (GC or CG) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a large net positive charge on the normally negatively charged tail of the encoded peptide. (J:298827)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pole3 Mutation:  17 strains or lines available
References
Original:  J:298827 Siamishi I, et al., Lymphocyte-Specific Function of the DNA Polymerase Epsilon Subunit Pole3 Revealed by Neomorphic Alleles. Cell Rep. 2020 Jun 16;31(11):107756
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory