Pole3em3Tbo
Endonuclease-mediated Allele Detail
|
Symbol: |
Pole3em3Tbo |
Name: |
polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 3, Thomas Boehm |
MGI ID: |
MGI:6490635 |
Synonyms: |
Pole3m3 |
Gene: |
Pole3 Location: Chr4:62440889-62443305 bp, - strand Genetic Position: Chr4, 33.17 cM, cytoband C1
|
Alliance: |
Pole3em3Tbo page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: A deletion-insertion (delGinsTA) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a moderate net positive charge on the normally negatively charged tail of the encoded peptide.
(J:298827)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Pole3 Mutation: |
15 strains or lines available
|
|
Original: |
J:298827 Siamishi I, et al., Lymphocyte-Specific Function of the DNA Polymerase Epsilon Subunit Pole3 Revealed by Neomorphic Alleles. Cell Rep. 2020 Jun 16;31(11):107756 |
All: |
1 reference(s) |
|