Stra8em4Keish
Endonuclease-mediated Allele Detail
|
Symbol: |
Stra8em4Keish |
Name: |
stimulated by retinoic acid gene 8; endonuclease-mediated mutation 4, Kei-ichiro Ishiguro |
MGI ID: |
MGI:6488119 |
Synonyms: |
Stra8 KO |
Gene: |
Stra8 Location: Chr6:34897098-34916279 bp, + strand Genetic Position: Chr6, 15.2 cM
|
Alliance: |
Stra8em4Keish page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Epitope tag, Null/knockout, Reporter) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele is derived from the Stra8em1Keish allele, which was generated as follows: sequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs targeting GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. Subsequent CRISPR/Cas9 targeting with a crRNA (targeting ACAGATCGTCAAAGGTCTCC(agg) in exon 9) and tracrRNA resulted in a 1 bp (A) deletion.
(J:290712)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Stra8 Mutation: |
34 strains or lines available
|
|
Original: |
J:290712 Ishiguro KI, et al., MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. Dev Cell. 2020 Feb 24;52(4):429-445.e10 |
All: |
1 reference(s) |
|