About   Help   FAQ
Stra8em1Keish
Endonuclease-mediated Allele Detail
Summary
Symbol: Stra8em1Keish
Name: stimulated by retinoic acid gene 8; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro
MGI ID: MGI:6488093
Synonyms: Stra8-3FH-p2A-GFP KI, Stra8-3xFLAG-HA-p2A-GFP KI
Gene: Stra8  Location: Chr6:34897098-34916279 bp, + strand  Genetic Position: Chr6, 15.2 cM
Alliance: Stra8em1Keish page
Mutation
origin
Strain of Origin:  (C57BL/6J x 129S6/SvEvTac)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Reporter)
Mutation:    Insertion
 
Mutation detailsSequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. (J:290712)
Expression
In Mice Carrying this Mutation: 3 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Stra8 Mutation:  36 strains or lines available
References
Original:  J:290712 Ishiguro KI, et al., MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. Dev Cell. 2020 Feb 24;52(4):429-445.e10
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory