About   Help   FAQ
Lrrc55osem1Caox
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrrc55osem1Caox
Name: leucine rich repeat containing 55, opposite strand; endonuclease-mediated mutation 1, Xuetao Cao
MGI ID: MGI:6477292
Synonyms: lncLrrc55-AS
Gene: Lrrc55os  Location: Chr2:85002869-85004284 bp, + strand  Genetic Position: Chr2, 49.48 cM
Alliance: Lrrc55osem1Caox page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout, Reporter)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsExon 1 was targeted with sgRNAs (TAGGCTCTCTGCAATGGCTGAC, AAACGTCAGCCATTGCAGAGAG, TAGGGGTAAGCAGGTTGCTGA and AAACCTCAGCAACCTGCTTACC) and a donor plasmid containing a GFP gene and poly(A) signal sequence using CRISPR/Cas9 technology. This resulted an a knockout reporter allele where exon 1 is replaced with the GFP gene. (J:293325)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lrrc55os Mutation:  0 strains or lines available
References
Original:  J:293325 Zhou Y, et al., Interferon-inducible cytoplasmic lncLrrc55-AS promotes antiviral innate responses by strengthening IRF3 phosphorylation. Cell Res. 2019 Aug;29(8):641-654
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory