About   Help   FAQ
Slc16a5em2Memo
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc16a5em2Memo
Name: solute carrier family 16 (monocarboxylic acid transporters), member 5; endonuclease-mediated mutation 2, Marilyn E Morris
MGI ID: MGI:6473946
Synonyms: Mct6-
Gene: Slc16a5  Location: Chr11:115353300-115365224 bp, + strand  Genetic Position: Chr11, 80.84 cM
Alliance: Slc16a5em2Memo page
Mutation
origin
Strain of Origin:  C57BL/6NCr
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in a 108 bp deletion. (J:293663)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slc16a5 Mutation:  15 strains or lines available
References
Original:  J:293663 Jones RS, et al., Characterization and Proteomic-Transcriptomic Investigation of Monocarboxylate Transporter 6 Knockout Mice: Evidence of a Potential Role in Glucose and Lipid Metabolism. Mol Pharmacol. 2019 Sep;96(3):364-376
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory