Rorcem1Litt
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rorcem1Litt |
| Name: |
RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Dan R Littman |
| MGI ID: |
MGI:6467245 |
| Synonyms: |
Rorc-TS |
| Gene: |
Rorc Location: Chr3:94280106-94305583 bp, + strand Genetic Position: Chr3, 40.56 cM, cytoband F2
|
| Alliance: |
Rorcem1Litt page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details:
CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon of the variant coding region (immediately before the stop codon.TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rorc exon: CTGCCACCCAAAGGAAAACTCCGGAGCCTGTGCAGCCAACATGTGGAAAAGCTGCAGATCTTCCAGCACCTCCACCCCATCGTGGTCCAAGCCGCCTTCCCTCCACTCTATAAGGAACTCTTCAGCACTGATGTTGAATCCCCTGAGGGGCTGTCAAAG] ggaggcggatcgggaggcggatcgggcggatcggca TGGTCGCATCCGCAGTTTGAAAAA ggaggcggatcgggaggcggatcgggcgga TCCGCT TGGTCGCATCCGCAGTTTGAAAAG [TGA stop].
(J:101977)
|
|
|
|
|
| Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
| All: |
1 reference(s) |
|