About   Help   FAQ
Rorcem1Litt
Endonuclease-mediated Allele Detail
Summary
Symbol: Rorcem1Litt
Name: RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Dan R Littman
MGI ID: MGI:6467245
Synonyms: Rorc-TS
Gene: Rorc  Location: Chr3:94280106-94305583 bp, + strand  Genetic Position: Chr3, 40.56 cM, cytoband F2
Alliance: Rorcem1Litt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon of the variant coding region (immediately before the stop codon.TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rorc exon: CTGCCACCCAAAGGAAAACTCCGGAGCCTGTGCAGCCAACATGTGGAAAAGCTGCAGATCTTCCAGCACCTCCACCCCATCGTGGTCCAAGCCGCCTTCCCTCCACTCTATAAGGAACTCTTCAGCACTGATGTTGAATCCCCTGAGGGGCTGTCAAAG] ggaggcggatcgggaggcggatcgggcggatcggca TGGTCGCATCCGCAGTTTGAAAAA ggaggcggatcgggaggcggatcgggcgga TCCGCT TGGTCGCATCCGCAGTTTGAAAAG [TGA stop]. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rorc Mutation:  42 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory