Cmtm4^em1Wlh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cmtm4^em1Wlh
• Name: CKLF-like MARVEL transmembrane domain containing 4; endonuclease-mediated mutation1, WenLing Han
• MGI ID: MGI:6457028
• Synonyms: Cmtm4 KO
• Gene: Cmtm4 Location: Chr8:105074823-105122439 bp, - strand Genetic Position: Chr8, 53.04 cM
• Alliance: Cmtm4^em1Wlh page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: Exon 1 was targeted with gRNAs (AGCGCGCCGCGCAGGTAGTC and GAGGAGCTGGACGGCTTCGA) using CRISPR/Cas9 technology, resulting in a 179 bp deletion that includes the ATG translation start codon. (J:294647)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cmtm4 Mutation: 11 strains or lines available

References

• Original: J:294647 Liu F, et al., Integrated Analyses of Phenotype and Quantitative Proteome of CMTM4 Deficient Mice Reveal Its Association with Male Fertility. Mol Cell Proteomics. 2019 Jun;18(6):1070-1084
• All: 1 reference(s)