About   Help   FAQ
Tra2bem1H
Endonuclease-mediated Allele Detail
Summary
Symbol: Tra2bem1H
Name: transformer 2 beta; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6451746
Synonyms: TRA2B-FLOX-EM1-B6, Tra2bPEfl
Gene: Tra2b  Location: Chr16:22063302-22084755 bp, - strand  Genetic Position: Chr16, 13.18 cM
Alliance: Tra2bem1H page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation details This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CATGCATTTTGAGAGTCCAA, GATCTGTTCAACCCACCCTT, GGTGGGTTGAACAGATCTAT, and GTGGTCTTCTTAATGCCCTT. This resulted in deletion(s) of 59 bp (location: Chr16:22078501-22078559; GRCm39), 61 bp (location: Chr16:22077371-22077431; GRCm39) and insertions of 62 bp (location: chr16:22077370; GRCm39), 63 bp (location: chr16:22078560; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tra2b Mutation:  24 strains or lines available
References
Original:  J:360846 Dalgliesh C, et al., An ultra-conserved poison exon in the Tra2b gene encoding a splicing activator is essential for male fertility and meiotic cell division. EMBO J. 2025 Jan 2;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory