Rhbdf1em1Mvw
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rhbdf1em1Mvw |
| Name: |
rhomboid 5 homolog 1; endonuclease-mediated mutation 1, Michael Wiles |
| MGI ID: |
MGI:6446985 |
| Synonyms: |
Rhbdf1v |
| Gene: |
Rhbdf1 Location: Chr11:32159585-32172300 bp, - strand Genetic Position: Chr11, 18.83 cM
|
| Alliance: |
Rhbdf1em1Mvw page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Hypomorph, Modified isoform(s)) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This CRISPR/cas9 mediated 572 bp deletion spans from the intron before exon 2 into the intron after exon 3 beginning at TTCAGGCCCAGAGCATGCCA and ending after GAATCCCTGTTAGGTACCAG and deletes exons 2 and 3, which includes the first ATG start site. RNA-Seq shows transcript that includes exons 1 and 4 through 18 and analysis indicates this allele produces mostly functional protein from an alternative AUG and non-AUG start codons.
(J:291556)
|
| Inheritance: |
|
Recessive |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rhbdf1 Mutation: |
41 strains or lines available
|
|
| Original: |
J:291556 Hosur V, et al., Genes adapt to outsmart gene-targeting strategies in mutant mouse strains by skipping exons to reinitiate transcription and translation. Genome Biol. 2020 Jul 9;21(1):168 |
| All: |
1 reference(s) |
|