About   Help   FAQ
Rhbdf1em1Mvw
Endonuclease-mediated Allele Detail
Summary
Symbol: Rhbdf1em1Mvw
Name: rhomboid 5 homolog 1; endonuclease-mediated mutation 1, Michael Wiles
MGI ID: MGI:6446985
Synonyms: Rhbdf1v
Gene: Rhbdf1  Location: Chr11:32159585-32172300 bp, - strand  Genetic Position: Chr11, 18.83 cM
Alliance: Rhbdf1em1Mvw page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph, Modified isoform(s))
Mutation:    Intragenic deletion
 
Mutation detailsThis CRISPR/cas9 mediated 572 bp deletion spans from the intron before exon 2 into the intron after exon 3 beginning at TTCAGGCCCAGAGCATGCCA and ending after GAATCCCTGTTAGGTACCAG and deletes exons 2 and 3, which includes the first ATG start site. RNA-Seq shows transcript that includes exons 1 and 4 through 18 and analysis indicates this allele produces mostly functional protein from an alternative AUG and non-AUG start codons. (J:291556)
Inheritance:    Recessive
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rhbdf1 Mutation:  41 strains or lines available
References
Original:  J:291556 Hosur V, et al., Genes adapt to outsmart gene-targeting strategies in mutant mouse strains by skipping exons to reinitiate transcription and translation. Genome Biol. 2020 Jul 9;21(1):168
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory