Rhbdf1^em1Mvw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rhbdf1^em1Mvw
• Name: rhomboid 5 homolog 1; endonuclease-mediated mutation 1, Michael Wiles
• MGI ID: MGI:6446985
• Synonyms: Rhbdf1^v
• Gene: Rhbdf1 Location: Chr11:32159585-32172300 bp, - strand Genetic Position: Chr11, 18.83 cM
• Alliance: Rhbdf1^em1Mvw page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph, Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: This CRISPR/cas9 mediated 572 bp deletion spans from the intron before exon 2 into the intron after exon 3 beginning at TTCAGGCCCAGAGCATGCCA and ending after GAATCCCTGTTAGGTACCAG and deletes exons 2 and 3, which includes the first ATG start site. RNA-Seq shows transcript that includes exons 1 and 4 through 18 and analysis indicates this allele produces mostly functional protein from an alternative AUG and non-AUG start codons. (J:291556)
• Inheritance: Recessive

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rhbdf1 Mutation: 43 strains or lines available

References

• Original: J:291556 Hosur V, et al., Genes adapt to outsmart gene-targeting strategies in mutant mouse strains by skipping exons to reinitiate transcription and translation. Genome Biol. 2020 Jul 9;21(1):168
• All: 1 reference(s)